Piltdown man Hoax Blog Post

Piltdown Hoax

                The Piltdown man is a one of the most famous hoax that present bone fragments showing the fossilized of an unknown early human. It start in England with a group of collectors, which consist of Charles Dawson, Arthur Smith, Woodward, Elliot smith, F.O. Barlow, Arthur Keith, W.P. Pycraft, and Sir Ray Lankester. The group creates forgery pieces of bone to present as a skull of a fully developed modern human. Which suppose to help scientist understand the human evolution until it was exposed as a forgery 40 years later. The hoax was discovered by scientific investigation because the fossil show inconsistent pattern of hominid evolution and later show by testing the bone itself with the fluorine content of fossil and roughly estimate the date of the fossil and it show that the age of the fossil were really young. This help scientist see that the fossil could be forgery, this show the important that they need more test to prove that it actually if it’s forgery.

                After understanding more about the Piltdown man hoax it present a very interest idea about scientist being curious, creative, and persistent. I find that it is really interesting. That scientist developed a way which help testing everything and make sure that every data they collect match and be useful for the next experiment to come. But being human scientist are at fault also. What if the forgery that have been made hold some of the useful information that help with the evolution process but people discard them because it was a forgery.  If scientist make a step back and take a look at it instead of disregard of it all they may find something useful in it. Which would be identifying as “There is no missing link” since there are an indefinite number of missing branches and each of them can connect to many different branches.

                But even all that scientific process help discover the flaw of the Piltdown man hoax and the scientific process responsible for revealing the fraud is the scientific method. The scientific method is first to “ask a question”,  second is to do “background research”, third is to construct a hypothesis, fourth is to test hypothesis with experiment, fifth is to analyze the data and come up with a conclusion, lastly report the result and see if your hypothesis were correct of not. I find this tool to be what help scientist receive the most correct data. Especially Do background research definitely help providing accurate information about the Piltdown skull and help scientist figure out the forgery to help create a correct data.

                In the Piltdown man hoax has present a very important flaw of the human factor not just scientist but human individual. Some people want fame and glory, some people want to find the truth and some do it for the money. I believe that scientific method is very important development that help reduce the chance of errors like this to happen again. But also human factor are very important to science because without fame, glory, truth, or money. Many people won't have motivation to find what is important. This is what make science very interesting. As a life lesson is it is important to verified the sources before publish the data to present the truth and won't have to find out 40 years later to fix the problems.

Comparative Primate Blog

1.       Compare the expression of one particular type of trait across five categories of primates, specifically comparing a designated representative of each category. The chosen primates for this assignment are as follow (with their grouping in parentheses)

a.       Lemurs (Prosimians/ Strepsihini)

b.      Spider Monkey (New World Monkey/ Platyrrhini)

c.       Baboon (Old World Monkey/ Cercopithecidae)

d.      Gibbon (Lesser ape/ Hylobatidae)

e.      Chimpanzee (Great ape/Hhominidae)

2.       The traits you will be comparing across these five primate will be distributed alphabetically across the class. Only compare this one assigned trait! Check the List below and locate the trait you will be analyzing for your blog post by finding the topic next to the letter grouping that matches the first letter in your last name.

a.       DEFGH: Diet

3.       For each of the five primates you will provide three set of information:

·         Lemurs (Prosimians/ Strepsihini)

                                                               i.       A thorough description of the environment in which the primates lives

·         Lemurs are primates found only in Africa on Madagascar Island. Most lemurs are living on tree and spend most of the time in the forest

                                                             ii.      A description of specified character trait for the primate.

·         Diets of lemur are normally consisting of Fruit, leaves, and small insects.

                                                            iii.      A discussion on how the primate’s trait expression has been influenced by its environment, i.e. how can the trait be view as an adaptation to the primate’s environment.

·         The Strepsihini diet trait are very similar to lemurs they eat insects and leaves. There were very little adaptation in this primates.

·         Spider Monkey (New World Monkey/ Platyrrhini)

                                                               i.       A thorough description of the environment in which the primates lives

·         Spider monkey live in central and south America; spending most time in  rain forest

                                                             ii.      A description of specified character trait for the primate.

·         Spider monkey  is an omnivore animal mainly eat fruit, blend of animal or small insects.

                                                            iii.      A discussion on how the primate’s trait expression has been influenced by its environment, i.e. how can the trait be view as an adaptation to the primate’s environment.

·         The new world monkey diet is also an omnivores. That like to pick up fruits and insects on tree.

·         Baboon (Old World Monkey/ Cercopithecidae)

                                                               i.       A thorough description of the environment in which the primates lives

·         The Baboon is the most adaptable animal they live across Africa.

                                                             ii.      A description of specified character trait for the primate.

·         The Diet of baboons are omnivorous they pretty much eat anything. They also adapt to everything to fit their diet.

                                                            iii.      A discussion on how the primate’s trait expression has been influenced by its environment, i.e. how can the trait be view as an adaptation to the primate’s environment.

·         The Old World Monkey diet is also an omnivorous

·         Gibbon (Lesser ape/ Hylobatidae)

                                                               i.       A thorough description of the environment in which the primates lives

·         The Gibbons belong in dense jungles and tropical rainforest acroess south asia.

                                                             ii.      A description of specified character trait for the primate.

·         Gibbons is another omnivorous animal which mean they also do eat both plant and animal as food. Primary prefer eating fruits

                                                            iii.      A discussion on how the primate’s trait expression has been influenced by its environment, i.e. how can the trait be view as an adaptation to the primate’s environment.

·         Lesser ape diet like the rest of the primate are omnivorous.

·         Chimpanzee (Great ape/Hhominidae)

                                                               i.       A thorough description of the environment in which the primates lives

·         Chimpanzees are found in Africa around Senegal in the west to Tanzania in the east.

                                                             ii.      A description of specified character trait for the primate.

·         The diets of chimpanzees mainly eat fruit and flower. But some group regularly hunt and consume meat

                                                            iii.      A discussion on how the primate’s trait expression has been influenced by its environment, i.e. how can the trait be view as an adaptation to the primate’s environment.

·         The diets of Great ape are mainly fruits, plants, and meat. Which would also show that they are omnivores as well

4.   Summarize your findings, evaluating the level of influence the environment has on the expression of physical and behavioral traits.

                                                               i.            What I found out in this research is that all primates are omnivores. Which help them easier at adapting in different environment.  Physically they have arms, legs, head, and normal body. Some of them have tail. Some does not. Their behavior is that they like to stay in group.

Work Cites

Lemur

http://animals.nationalgeographic.com/animals/mammals/ring-tailed-lemur/

http://pin.primate.wisc.edu/factsheets/entry/ring-tailed_lemur/behav

http://animals.nationalgeographic.com/animals/mammals/ring-tailed-lemur/

Spider Monkey

http://www.nhc.ed.ac.uk/index.php?page=493.504.513

http://animals.nationalgeographic.com/animals/mammals/spider-monkey/

http://anthro.palomar.edu/primate/prim_5.htm

Baboon

http://www.imfene.org/baboon-biology/baboon-ecology

http://anthro.palomar.edu/primate/prim_6.htm

Gibbons & Chimpanzee

http://a-z-animals.com/animals/gibbon/

http://www.clemetzoo.com/apetag/aboutApes.html

Homology / Analogy Blog Post

Blog 3

1.        Homologues

a.       Human Tail Bone and Monkey Tail; The homologues trait they both possess is that they both have tail bone.

b.      The Homologues of Human Tail Bone and Monkey Tail. The Human Tailbone and Monkey tail have similarity trait but as evolution have gone human vestigiality of it structure express the lost function as to where monkey can use it to grab hold on to something and move it tail around.

c.       Human share common ancestor with African Apes; Monkey ancestor with Primate. Although they are very practically almost the same species monkeys are much smaller than apes and humans.

d.          

2.       Analogous

a.       Human and Snakes; The analogous trait both possess is they both have femur but use for different thing

b.      The Analogous trait between human and snake is that human is mammals and snake is a reptiles. But they both still have femur. For human is use for walking and jumping but as for snake it is useless and just floats.

c.       Yes, it is possible that the common ancestor did process analogous trait. Possibly that snake could walk before but change over time to fit the environment.

d.                 

DNA STRAND

AGTGTACACGCTGGTTTAAGTGAGCTGGAAATTTGTCTATCATCG