Human Variation & Race Blog

1.       Cold is one of the following environmental stresses that have negatively impacts to the survival of humans by disturbing homeostasis.

2.       Identify 4 ways that humans adapt to cold

·         Short Term Adaptation: Drink and eat warm food to produce heat to your body.

 

·         Facultative Adaptation: Limiting activity to the warmest place.

 

·         Developmental Adaptations: Humans in colder climates tend to be shorter, larger, have shorter limbs.

 

·         Cultural adaptations: Put more insulating and warmer clothes or warm fires place.

 

 

3.       Benefits of studying human variation from this perspective across environmental clines is important because you can track the movement of traits, and environment to help surviving in harsh environment.

4.       How would you use race to understand the variation of the adaptation.

·         The race variation show the important of variation in adaptations, such as an example for cold, form experience comparing my cousin from Thailand who is Asian compare to my Caucasian friend. My cousin feels the cold easier than my friend. The way my cousin would adapt toward the cold weather would be wearing more layer of warmer clothes than my friends

Language Blog

This experiment was start by taking a part in conversation for 15 minutes where I were not allow to talk I find this experiment where I was not allowed to speak to my partner having a conversation is pretty easy and hard during the 15 minutes. The easy part is that it was my little sister who I talk to, She understand some of the message I was trying to convey, but some part where I try to describe to her it’s like playing charade and it was difficult to talk to her about certain subjects that are hard to describe without words like her homework assignment. My sister didn’t alter her way of communication that much. I think it’s because she’s an art student who like visualizing. So it was simple for her to understand most of what I was trying to say when we did this experiment. If my partner who having a conversation with me, speak in different language as me. I think both people would be difficult at understanding each other. Since the person that try to act out what is it may be able to convey information to the person that speak but then you won’t know if he really understand what you are trying to say and the person that say stuff to you would say in a completely different language that you won’t understand. I find that it is also interesting that because my sister and I like to speak in a language what we like to call “Thailish” which is the language of Thai and English combine together some part in Thai some part in English it is pretty entertaining.

The second part of this experiment which was for me to talk without be able to use any hand or any signal. It was really hard to last to 15 minutes it took me about 3 tries to finally last 15 minutes without making any hand gesture or try to hint with my eyebrows and many more. My sister says that it’s really difficult watching me because it has no expression or feeling in the language which is kind of throwing her off in what I was trying to convey some time. I think this experiment say that sign and signal in our way of communication because from what I experience it is making it harder to show our emotion in our way of communicate people may understand you what you are trying to say. But they may not understand why or what you really want which those emotions make it effective way to communicate. Some people  do have trouble reading other people body language but I think my sister did not have much trouble reading my body language because I have spend a lot of time with her all my life. I think body language is important and beneficial because If you can read someone else body language it’s really helpful to understand their emotion weather if they are sad or happy it is really important way to learn how to interact with people.

Piltdown man Hoax Blog Post

Piltdown Hoax

                The Piltdown man is a one of the most famous hoax that present bone fragments showing the fossilized of an unknown early human. It start in England with a group of collectors, which consist of Charles Dawson, Arthur Smith, Woodward, Elliot smith, F.O. Barlow, Arthur Keith, W.P. Pycraft, and Sir Ray Lankester. The group creates forgery pieces of bone to present as a skull of a fully developed modern human. Which suppose to help scientist understand the human evolution until it was exposed as a forgery 40 years later. The hoax was discovered by scientific investigation because the fossil show inconsistent pattern of hominid evolution and later show by testing the bone itself with the fluorine content of fossil and roughly estimate the date of the fossil and it show that the age of the fossil were really young. This help scientist see that the fossil could be forgery, this show the important that they need more test to prove that it actually if it’s forgery.

                After understanding more about the Piltdown man hoax it present a very interest idea about scientist being curious, creative, and persistent. I find that it is really interesting. That scientist developed a way which help testing everything and make sure that every data they collect match and be useful for the next experiment to come. But being human scientist are at fault also. What if the forgery that have been made hold some of the useful information that help with the evolution process but people discard them because it was a forgery.  If scientist make a step back and take a look at it instead of disregard of it all they may find something useful in it. Which would be identifying as “There is no missing link” since there are an indefinite number of missing branches and each of them can connect to many different branches.

                But even all that scientific process help discover the flaw of the Piltdown man hoax and the scientific process responsible for revealing the fraud is the scientific method. The scientific method is first to “ask a question”,  second is to do “background research”, third is to construct a hypothesis, fourth is to test hypothesis with experiment, fifth is to analyze the data and come up with a conclusion, lastly report the result and see if your hypothesis were correct of not. I find this tool to be what help scientist receive the most correct data. Especially Do background research definitely help providing accurate information about the Piltdown skull and help scientist figure out the forgery to help create a correct data.

                In the Piltdown man hoax has present a very important flaw of the human factor not just scientist but human individual. Some people want fame and glory, some people want to find the truth and some do it for the money. I believe that scientific method is very important development that help reduce the chance of errors like this to happen again. But also human factor are very important to science because without fame, glory, truth, or money. Many people won't have motivation to find what is important. This is what make science very interesting. As a life lesson is it is important to verified the sources before publish the data to present the truth and won't have to find out 40 years later to fix the problems.

Comparative Primate Blog

1.       Compare the expression of one particular type of trait across five categories of primates, specifically comparing a designated representative of each category. The chosen primates for this assignment are as follow (with their grouping in parentheses)

a.       Lemurs (Prosimians/ Strepsihini)

b.      Spider Monkey (New World Monkey/ Platyrrhini)

c.       Baboon (Old World Monkey/ Cercopithecidae)

d.      Gibbon (Lesser ape/ Hylobatidae)

e.      Chimpanzee (Great ape/Hhominidae)

2.       The traits you will be comparing across these five primate will be distributed alphabetically across the class. Only compare this one assigned trait! Check the List below and locate the trait you will be analyzing for your blog post by finding the topic next to the letter grouping that matches the first letter in your last name.

a.       DEFGH: Diet

3.       For each of the five primates you will provide three set of information:

·         Lemurs (Prosimians/ Strepsihini)

                                                               i.       A thorough description of the environment in which the primates lives

·         Lemurs are primates found only in Africa on Madagascar Island. Most lemurs are living on tree and spend most of the time in the forest

                                                             ii.      A description of specified character trait for the primate.

·         Diets of lemur are normally consisting of Fruit, leaves, and small insects.

                                                            iii.      A discussion on how the primate’s trait expression has been influenced by its environment, i.e. how can the trait be view as an adaptation to the primate’s environment.

·         The Strepsihini diet trait are very similar to lemurs they eat insects and leaves. There were very little adaptation in this primates.

·         Spider Monkey (New World Monkey/ Platyrrhini)

                                                               i.       A thorough description of the environment in which the primates lives

·         Spider monkey live in central and south America; spending most time in  rain forest

                                                             ii.      A description of specified character trait for the primate.

·         Spider monkey  is an omnivore animal mainly eat fruit, blend of animal or small insects.

                                                            iii.      A discussion on how the primate’s trait expression has been influenced by its environment, i.e. how can the trait be view as an adaptation to the primate’s environment.

·         The new world monkey diet is also an omnivores. That like to pick up fruits and insects on tree.

·         Baboon (Old World Monkey/ Cercopithecidae)

                                                               i.       A thorough description of the environment in which the primates lives

·         The Baboon is the most adaptable animal they live across Africa.

                                                             ii.      A description of specified character trait for the primate.

·         The Diet of baboons are omnivorous they pretty much eat anything. They also adapt to everything to fit their diet.

                                                            iii.      A discussion on how the primate’s trait expression has been influenced by its environment, i.e. how can the trait be view as an adaptation to the primate’s environment.

·         The Old World Monkey diet is also an omnivorous

·         Gibbon (Lesser ape/ Hylobatidae)

                                                               i.       A thorough description of the environment in which the primates lives

·         The Gibbons belong in dense jungles and tropical rainforest acroess south asia.

                                                             ii.      A description of specified character trait for the primate.

·         Gibbons is another omnivorous animal which mean they also do eat both plant and animal as food. Primary prefer eating fruits

                                                            iii.      A discussion on how the primate’s trait expression has been influenced by its environment, i.e. how can the trait be view as an adaptation to the primate’s environment.

·         Lesser ape diet like the rest of the primate are omnivorous.

·         Chimpanzee (Great ape/Hhominidae)

                                                               i.       A thorough description of the environment in which the primates lives

·         Chimpanzees are found in Africa around Senegal in the west to Tanzania in the east.

                                                             ii.      A description of specified character trait for the primate.

·         The diets of chimpanzees mainly eat fruit and flower. But some group regularly hunt and consume meat

                                                            iii.      A discussion on how the primate’s trait expression has been influenced by its environment, i.e. how can the trait be view as an adaptation to the primate’s environment.

·         The diets of Great ape are mainly fruits, plants, and meat. Which would also show that they are omnivores as well

4.   Summarize your findings, evaluating the level of influence the environment has on the expression of physical and behavioral traits.

                                                               i.            What I found out in this research is that all primates are omnivores. Which help them easier at adapting in different environment.  Physically they have arms, legs, head, and normal body. Some of them have tail. Some does not. Their behavior is that they like to stay in group.

Work Cites

Lemur

http://animals.nationalgeographic.com/animals/mammals/ring-tailed-lemur/

http://pin.primate.wisc.edu/factsheets/entry/ring-tailed_lemur/behav

http://animals.nationalgeographic.com/animals/mammals/ring-tailed-lemur/

Spider Monkey

http://www.nhc.ed.ac.uk/index.php?page=493.504.513

http://animals.nationalgeographic.com/animals/mammals/spider-monkey/

http://anthro.palomar.edu/primate/prim_5.htm

Baboon

http://www.imfene.org/baboon-biology/baboon-ecology

http://anthro.palomar.edu/primate/prim_6.htm

Gibbons & Chimpanzee

http://a-z-animals.com/animals/gibbon/

http://www.clemetzoo.com/apetag/aboutApes.html

Homology / Analogy Blog Post

Blog 3

1.        Homologues

a.       Human Tail Bone and Monkey Tail; The homologues trait they both possess is that they both have tail bone.

b.      The Homologues of Human Tail Bone and Monkey Tail. The Human Tailbone and Monkey tail have similarity trait but as evolution have gone human vestigiality of it structure express the lost function as to where monkey can use it to grab hold on to something and move it tail around.

c.       Human share common ancestor with African Apes; Monkey ancestor with Primate. Although they are very practically almost the same species monkeys are much smaller than apes and humans.

d.          

2.       Analogous

a.       Human and Snakes; The analogous trait both possess is they both have femur but use for different thing

b.      The Analogous trait between human and snake is that human is mammals and snake is a reptiles. But they both still have femur. For human is use for walking and jumping but as for snake it is useless and just floats.

c.       Yes, it is possible that the common ancestor did process analogous trait. Possibly that snake could walk before but change over time to fit the environment.

d.                 

DNA STRAND

AGTGTACACGCTGGTTTAAGTGAGCTGGAAATTTGTCTATCATCG

Blog 1 Georges Cuvier

Georges Cuvier a scientist and naturalist, His contribution to scientific community is the developed paleontology and catastrophist. Which is the idea that each strata boundary corresponds to some catastrophic event.

The Bullet point that directly affect Georges Cuvier and Darwin the most is the bullet "If the environment change, the traits that are helpful or adaptive to that environment will be different." Since Georges Cuvier idea explain that a catastrophic event help involve in evolution it would be best to support Darwin idea of evolution. The catastrophic event that happen toward environment present the issue of natural selection because the strongest are able to adapt and survive pass that catastrophic event.

I believe that Darwin cannot developed his theory of natural selection without the influence of Georges Cuvier ideas. Since if Darwin does not include the idea of environment into natural selection then that would really defeat the purpose of the natural selection theory.

Lastly as to how did the church attitude affect Darwin and his book On the Origin of Species. would be that the church didn't accept Darwin ideas and mention that it should be separated between religion and evolution to be taught.

(http://www.pbs.org/wgbh/evolution/library/02/1/l_021_01.html)